Implication of ermCX gene of Corynebacterium striatum in macrolide resistance in Beijing, China
Abstract
To study the resistance mechanism of Corynebacterium striatum clinical isolates to macrolide antibiotic, 57 strains of C. striatum clinical isolates were detected by susceptibility testing, PCR amplification and DNA sequencing. The MICs of erythromycin and azithromycin were measured. The Staphylococcus aureus (ATCC 29213) strain was used as control strain for susceptibility testing. A novel pair of specific primers for C. striatum was firstly designed. Out of the 57 strains of C. striatum isolates there were 9 strains of ermCX-carrying isolates screened. The amplified ermCX gene of C. striatum was characterized. High MICs (≥256 mg/L) of erythromycin and azithromycin was showed in 9 strains which carried ermCX gene. Thus, ermCX gene plays an important role in resistant mechanism of C. striatum in China to macrolide antibiotic. The ermCX gene DNA sequences of two strains (one C. striatum from blood and one C. striatum from pleural fluid) were submitted to GenBank database.
Introduction
Corynebacterium striatum is frequently found among clnical isolates of corynebacteria in China and usually regarded as a kind of contaminant in clinical laboratory. However, infections caused by C. striatum emerged increasingly such as pneumonia (Tarr et al., 2003) vertebral osteomyelitis (Fernández-Ayala et al., 2001) septicemia (MartÃn et al., 2003) and endocarditis (de Arriba et al., 2002). It has increasingly been recognized as opportunistic pathogen even pathogen (Campanile et al., 2009). The rising importance in the clinical infection of C. striatum makes it necessary to know its susceptibility to the clinical antibiotic. Because of the abusage of antibiotic, an alarming rate of antibiotic resistance among C. striatum was developing. Soriano et al. (1998) reported the MIC50 (MIC at which 50% of the isolates tested are inhibited) and the MIC90 (MIC at which 90% of the isolates tested are inhibited) of erythromycin and azithromycin (>128 mg/L) for 25 strains of C. striatum clinical isolates. A multidrug-resistant strain of C. striatum only susceptible to rifampin and vancomycin was reported in 2003 (Tarr et al., 2003). In 2006 Otsuka Y described the emergence of multidrug-resistant Corynebacterium striatum as a nosocomial pathogen in long-term hospitalized patients with underlying diseases (Otsuka et al., 2006). Bacteriemia caused by a multidrug-resistant strain is fatal to immunocompromised crowd. All these reminds us to concern the resistance for C. striatum to antibiotic. Macrolide antibiotic such as erythromycin and azithromycin was widely applied in clinical treatment. It is very significant for controlling resistance to study macrolide antibiotic resistance mechanism. Therefore, the main aim of this study was to learn the mechanisms of resistance to macrolide antibiotic in C.Striatum.
Materials and Methods
Bacterial strains and identification
57 strains of C. striatum were isolated in the Department of Clinical Laboratory Medicine, People’s Hospital of Peking University and China-Japan Friendship Hospital between June 2000 and June 2006. All of the strains were identified by the API Coryne system (bioMe´rieux, Marcy l’E´toile, France). In our previous study (Li and Zhang, 2007), the standard according to which the partial strains were chosen and the analysis of susceptibility testing of these strains were mentioned.
Antimicrobial agents
Erythromycin and azithromycin were from National Institute For The Control of Pharmaceutical and Biological (Beijing, China).
MIC determinations
The MICs of erythromycin and azithromycin were determined against 57 strains of C. striatum by a standard agar dilution method (Clinical and Laboratory Standards Institute, 2010). Briefly, inocula of approximately 104 CFU per spot were applied to the surface of Mueller-Hinton agar (Oxoid, Basingstoke, UK) supplemented with 5% defibrinated sheep blood containing doubling dilutions of antibiotics from 0.00098 to 512 mg/L. Plates were incubated aerobically at 35°C for 24 or 48 hours, as required, to determine the MIC end-point. There are no specific guidelines by Clinical and Laboratory Standards Institute for the susceptibility testing of corynebacteria (Clinical and Laboratory Standards Institute, 2010). Any criteria defined for C. striatum is unsuitable. All strains of C. striatum were chosen to seek for ermCX gene. Staphylococcus aureus (ATCC 29213) was used as control.
Amplification and sequence of ermCX gene
To amplify the ermCX gene of C. striatum, a couple of primers for ermCX were firstly used. Based on the sequence of gene ermCX on C. striatum R-plasmid pTP10 a novel pair of specific primers for C. striatum was designed by Primer 5 software: E1 (CGGGTTTGGTGTAGATGGTGAG) and E2 (CGTTTCGGCAGATACGCTTTC). The PCRs were performed as follows. One colony was resuspended in nucleic acid extracted tube (Lot: 200612004. Beijing CapitalBio Co., Ltd), 50 μL of lysate buffer was added and shaken for 5 min, followed by incubation for 5 min at 95°C. Afterward, as genomic DNA (about 5-50 ng), 3 μL of the supernatant of the tube were added to 20 μL final volume PCR reactions containing MgCl2 2.0 mM, 200 μM each of dATPs, dCTPs, dGTPs and dTTPs, 50 mM KCl, 10 mM Tris-HCl (pH 9.0), 0.1% Triton X-100, 1 U Taq polymerase. 10 pmol of each primer were added too. Oligonucleotides were synthesized by Beijing SBS Genetech Co., Ltd (Beijing, China). The PCR is conducted under the condition of a pre-denaturation at 94°C for 5 min, followed by 30 cycles of 94°C for 1 min, 62°C for 1 min and 72°C for 1 min, and a final extension step was performed at 72°C for 5 min. Amplified products were electrophoresised in 1.2% agarose and stained with 0.5 μg/mL ethidium bromide and photographed with GENIUS Image System. PCR product of corresponding size of DNA was purified with gel purification and sequenced by BGI LifeTech Co., Ltd. (Beijing, China). Afterward, the corresponding size of DNA sequence was blasted on http://www.ncbi.nlm.nih.gov/.
Results
The results of the tests in which the MICs of erythromycin and azithromycin for the clinical isolates of C.striatum were determined are presented in Table I. The MICs for control strain of Staphylococcus aureus (ATCC 29213) was within normal range (Table I). There were high-level resistance to erythromycin and azithromycin. MIC50 and MIC90 of erythromycin were both 512 mg/L. Azithromycin was little better than erythromycin (MIC at which 50% of the isolates tested are inhibited of 256 mg/L). MIC90 of azithromycin remains 512 mg/L. MICs of erythromycin ranging between 32 and 512 mg/L. The range of MICs of azithromycin was broader (16 to 512 mg/L).
Table I:MICs of erythromycin and azithromycin for 57 strains of C. striatum (unit: mg/L)
| Antibacterial agent | MICs of 57 strains of C. striatum | MICs of control | ||
|---|---|---|---|---|
| Range | MIC50 | MIC90 | ATCC 29213 |
|
| Erythromycin | 32 - 512 | 512 | 512 | 0.5 |
| Azithromycin | 16 - 512 | 256 | 512 | 2.0 |
Among the 57 strains of C. striatum isolates, 9 strains with ermCX gene were screened out，the detection rate was 15.8% (9/57). Amplified products were sequenced and blasted with GenBank database. It showed 100% identity and 100% similarity to the C. striatum R-plasmid pTP10 at position 48741 to 49501, just was ermCX gene. The ermCX gene DNA sequences of two strains (one C.striatum isolated from blood and one C.striatum from pleural fluid) were submitted to GenBank database under Accession No. EF608448-608449 (Table II). High MICs (≥256 mg/L) of erythromycin and azithromycin was showed in 9 strains which carried ermCX gene (Table II).
Table II: Analysis of 9 strains of ermCX-carrying C. striatum (unit: mg/L)
| No. | Strains | Specimens | MICs (mg/L) | Genbank accession number | |
|---|---|---|---|---|---|
| Erythromycin | Azithromycin | ||||
| 1 | C. striatum | Bronchofibroscope secretion | 512 | 512 | |
| 2 | C. striatum | Bronchofibroscope secretion | 512 | 512 | |
| 3 | C. striatum | Bronchofibroscope secretion | 512 | 512 | |
| 4 | C. striatum | Bronchofibroscope secretion | 256 | 256 | |
| 5 | C. striatum | Blood | 512 | 512 | EF608448 |
| 6 | C. striatum | Bronchofibroscope secretion | 512 | 512 | |
| 7 | C. striatum | Pleural fluid | 512 | 512 | EF608449 |
| 8 | C.striatum | Bronchofibroscope secretion | 512 | 512 | |
| 9 | C.striatum | Bronchofibroscope secretion | 256 | 256 | |
Discussion
Erythromycin and azithromycin are clinically important broad-spectrum antibiotic that belongs to the macrolide class. However the application of macrolide antibiotic was influenced due to the resistance. It is very significant for controlling resistance to study macrolide antibiotic resistance mechanism. The macrolide
resistance determinants and genetic elements mainly carried the mef gene and erm gene. An important resistance mechanism to macrolide antibiotic was to modify or reconstitute the site in 23 S rRNA on the large ribosomal subunit (50S) close to the peptidyl transferase center. This kind of resistance was conferred by four kinds of mechanism: The mutation in the base of the large ribosomal subunit on 23 S rRNA; the mutation in protein; the presence of resistant short peptide and the presence of erm methyltransferases. The target for erm methyltransferases is at nucleotide A2058 in 23S rRNA, and erm methylation occurs before the rRNA has been assembled into 50S ribosomal particles. Erm methyltransferases are a clinically prevalent group of enzymes that confer resistance to the therapeutically important macrolide, lincosamide, and streptogramin B (MLSB) antibiotics, it was encoded by erm dimethyltransferase genes which was founded in many pathogenic bacteria. Erm methyltransferases occur in a phylogenetically wide range of bacteria and differ in whether they add one or two methyl groups to the A2058 target (Douthwaite et al., 2008). Clinical isolates of Streptococcus pneumoniae with constitutive erm(B) and Streptococcus pyogenes with constitutive erm(A) subtype (TR) are resistant to macrolides (Douthwaite et al., 2005). Staphylococcus aureus encoded methyltrans-ferases by ermAã€ermBã€ermC and ermF. Tauch et al. reported that the erythromycin resistance gene, ermCX, is located on a 4524-bp composite transposable element, Tn5432 in the 50-kb R-plasmid pTP10 from the clinical isolate Corynebacterium xerosis M82B (Tauch et al., 1995). Nothing else has been published on ermCX about C. striatum, no report about the resistance caused by ermCX gene in clinical isolates. Based on the sequence of gene ermCX on C. striatum R-plasmid pTP10 at position 48741 to 49501, a novel pair of specific primers for C. striatum was firstly designed by Primer 5 software in the present study. Amplified products were sequenced and blasted with GenBank database. It showed 100% identical and 100% similarity to those of C. striatum R-plasmid pTP10 at position 48741 to 49501. The ermCX gene DNA sequences of two strains of C. striatum (one from blood and one from pleural fluid) were submitted to GenBank database under Accession No. EF608448-608449 (Table II).
There were high-level resistance to erythromycin and azithromycin among the 57 strains of C. striatum. MIC50 and MIC90 of erythromycin were both 512 mg/L. azithromycin was little better than erythromycin (MIC at which 50% of the isolates tested are inhibited of 256 mg/L). MIC90 of azithromycin remains 512 mg/L. It showed the serious resistance of macrolide antibiotic in C. striatum in Beijing, China. 9 strains of ermCX- carrying C. striatum showed high MICs, with MICs of erythromycin and azithromycin 512 mg/L except two 256 mg/L. It implicated that the ermCX gene was associated with the high-level resistance of macrolide antibiotic and played an important role in resistance of C. striatum to macrolide antibiotic. It could be ermCX gene that encodes the methyltransferases of C. striatum, thus the methyltransferases lead to the resistance to macrolide antibiotic. 9 strains with ermCX gene were screened out from 57 strains of C. striatum. The detection rate was 15.8%. Because that there are no specific guidelines by CLSI Standards for the susceptibility testing of corynebacteria, the proportion of ermCX-carring strains in those strains which is resistant to macrolide antibiotic couldn’t be analyzed. It was inferred that there could be other resistant gene or mechanism in those strains without ermCX gene that showed high level resistance to macrolide antibiotic.
Figure 1:Agarose gel electrophoresis of the products of PCR. Lanes 1-4, samples; M, molecular weight markers (Beijing SBS Genetech Co., Ltd, China); N, represents the negative control without DNA template
Erm genes are not only common but also circulate among species of this bacterial genus (Milagro et al., 2001).
Conclusion
In conclusion, as a family of erm genes which lead to the resistance to macrolide antibiotic, an important resistance gene of C. striatum, ermCX should be concerned. It is also necessary for hospital to take measures to control the resistance.
References
Campanile F, Carretto E, Barbarini D, Grigis A, Falcone M, Goglio A, Venditti M, Stefani S. Clonal multidrug-resistant Corynebacterium striatum strains, Italy. Emerg Infect Dis. 2009; 15: 75-78.
Clinical and Laboratory Standards Institute. Methods for dilution antimicrobial susceptibility testing for uncommon isolates or bacteria that grow aerobically; Approved Standards. CLSI documents M45-A. Clinical and Laboratory Standards Institute, 2010.
de Arriba JJ, Blanch JJ, Mateos F, MartÃnez-Alfaro E, Solera J. Corynebacterium striatum first reported case of prosthetic valve endocarditis. J Infect. 2002; 44: 193.
Douthwaite S, Jalava J, Jakobsen L. Ketolide resistance in Streptococcus pyogenes correlates with the degree of rRNA dimethylation by Erm. Mol Microbiol. 2005; 58: 613-22.
Douthwaite S, Jensen RL, Kirpekar F. The activity of rRNA resistance methyltransferases assessed by MALDI mass spectrometry. Methods Mol Med. 2008; 142: 223-37.
Fernández-Ayala M, Nan DN, Fariñas MC. Vertebral osteomyelitis due to Corynebacterium striatum. Am J Med. 2001; 111: 167.
Li W, Zhang Z. The identification and resistance analysis to 66 strains of corynebacterium clinical isolates. Chin J Lab Diag. 2007; 11: 932-36.
MartÃn MC, Melón O, Celada MM, Alvarez J, Méndez FJ, Vázquez F. Septicaemia due to Corynebacterium striatum: Molecular confirmation of entry via the skin. J Med Microbiol. 2003; 52: 599-602.
Otsuka Y, Ohkusu K, Kawamura Y, Baba S, Ezaki T, Kimura S. Emergence of multidrug-resistant Corynebacterium striatum as a nosocomial pathogen in long-term hospitalized patients with underlying diseases. Diagn Microbiol Infect Dis. 2006; 54: 109-14.
Reig M, Galan J, Baquero F, Perez-Diaz JC. Macrolide resistance in Peptostreptococcus spp. mediated by ermTR: Possible source of macrolide-lincosamide-streptogramin B resistance in Streptococcus pyogenes. Antimicrob Agents Chemother. 2001; 45: 630-32.
Soriano F, Fernández-Roblas R, Calvo R, GarcÃa-Calvo G. In vitro susceptibilities of aerobic and facultative non-spore-forming Gram-positive bacilli to HMR 3647 (RU 66647) and 14 other antimicrobials. Antimicrob Agents Chemother. 1998; 42: 1028-33.
Tarr PE, Stock F, Cooke RH, Fedorko DP, Lucey DR. Multidrug-resistant Corynebacterium striatum pneumoniae in a heart transplant recipient. Transpl Infect Dis. 2003; 5: 53-58.
Tauch A, Kassing F, Kalinowski J, Pühler A. The Corynebacterium xerosis composite transposon Tn5432 consists of two identical insertion sequences, designated IS1249, flanking the erythromycin resistance gene ermCX. Plasmid 1995; 34: 119-31.
